Skip to main content
Figure 3 | Molecular Autism

Figure 3

From: Whole-genome sequencing in an autism multiplex family

Figure 3

Illustration of the non-synonymous mutation in ANK3. (A) A UCSC genome browser shot of the ANK3 gene and the location of the mutation, together with sequence conservation patterns across 28 vertebrate species. (B) Validation of the mutation by Sanger sequencing in the family. The primers used are CTTCATGGTCATGGTGGATG (forward) and AGGGGGAAGGGGATAAAAGT (reverse).

Back to article page

Molecular Autism

ISSN: 2040-2392